View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6667_low_6 (Length: 308)
Name: NF6667_low_6
Description: NF6667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6667_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 50 - 268
Target Start/End: Complemental strand, 4972563 - 4972349
Alignment:
| Q |
50 |
atagataattttgttgggtttgggagatttaggatnnnnnnnntgataaagctgataaatttattaatttcataggaaacatgatgggaattgttgaaaa |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4972563 |
atagataattttgttgggtttgggagatttaggataaaaaaaattataaagctgataaatttattaatttcataggaaacatgatgggaattgttgaaaa |
4972464 |
T |
 |
| Q |
150 |
acatggtgattgattgtttgatatattggatattggaggtgattgcacttgcatttactgctttaaattattgattgtatttccctgttaagtagttatt |
249 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4972463 |
acatggtgattg----tttgatatattggatattggaggtgattgcacttgcagttactgctttaaattattgattgtatttccctgttaagtagttatt |
4972368 |
T |
 |
| Q |
250 |
tagtaatgattttaagatg |
268 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4972367 |
tagtaatgattttaagatg |
4972349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University