View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6667_low_7 (Length: 262)
Name: NF6667_low_7
Description: NF6667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6667_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 161 - 257
Target Start/End: Complemental strand, 26297900 - 26297804
Alignment:
| Q |
161 |
aaatacataaatcaagtagaataaacgttgaagattttctacttataaaacttaaatgttgaagatttcttgctaaacaagtgatgatgatgtccat |
257 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
26297900 |
aaatacataaatcaagtagaataaatgttgaagattttctacttataaaacttaaatgttgaagatttcttgttaaacaagtgatgatgatttccat |
26297804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 84 - 164
Target Start/End: Complemental strand, 26298532 - 26298452
Alignment:
| Q |
84 |
gctcaagacaaacatgcacccattttttatattatttataactacctatgaaactttggttttgagtttatgtgataaaat |
164 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
26298532 |
gctcaagacaaacttgcacccattttttagattatttataactacctatgtaactttggatttgagtttatgtgattaaat |
26298452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University