View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6667_low_8 (Length: 247)
Name: NF6667_low_8
Description: NF6667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6667_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 16173700 - 16173933
Alignment:
| Q |
1 |
ttttgactttcgtacatgatcgacaatctttagtacccttgatttcaatttcgatctcaaaatttgatcttgaatttcttgaatgactttggttctgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16173700 |
ttttgactttcgtacatgatcgacaatctttagtacccttgatttcaatttcgatctcaaaatttgatcttgaatttcttgaatgactttggttctgaat |
16173799 |
T |
|
| Q |
101 |
acttcttctaattttgtttgaactaaccattatgaatagcttctaatatgtaatctgaagtgcttctgatttgtactttcaagttctcttttattgaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16173800 |
acttcttctaattttgtttgaactaaccattctgaatagcttctaagatgtaatctgaagtgcttctgatttgtactttcaagttctcttttattgaaga |
16173899 |
T |
|
| Q |
201 |
attttgatcttatgattgacatgatgtttgcatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16173900 |
attttgatcttatgattgacatgatgtttgcatt |
16173933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 32 - 74
Target Start/End: Complemental strand, 29974870 - 29974828
Alignment:
| Q |
32 |
agtacccttgatttcaatttcgatctcaaaatttgatcttgaa |
74 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29974870 |
agtacccttgatttcaattatgatctcaaaatttgatcttgaa |
29974828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University