View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6668_high_13 (Length: 227)
Name: NF6668_high_13
Description: NF6668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6668_high_13 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 20 - 227
Target Start/End: Original strand, 50573252 - 50573459
Alignment:
| Q |
20 |
gaccggtatcatgcaaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50573252 |
gaccggtatcatgcaaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatt |
50573351 |
T |
 |
| Q |
120 |
tgtgnnnnnnnctcgtaatacttgattccttagcctttatttatgctttaggatttcaagattcgaagccatatgaatgtcaacttccgcagatggttgg |
219 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||| |
|
|
| T |
50573352 |
tgtgtttttttctcgtaatacttgattcctttgcctttatttatgctttaggatttcaagattcgcagccagatgaatgtcaacttccgcaaatggttgg |
50573451 |
T |
 |
| Q |
220 |
atggtctt |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
50573452 |
atggtctt |
50573459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 182
Target Start/End: Original strand, 50562094 - 50562138
Alignment:
| Q |
138 |
tacttgattccttagcctttatttatgctttaggatttcaagatt |
182 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||| ||||| |
|
|
| T |
50562094 |
tacttgattccttcggctttacttatgctttaggatttccagatt |
50562138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 115
Target Start/End: Original strand, 50567427 - 50567514
Alignment:
| Q |
25 |
gtatcatgcaaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaac |
115 |
Q |
| |
|
||||||| |||||| ||||||||| | |||||| ||||||||| ||| |||||||| |||||| ||| ||| ||||||||||||||| |
|
|
| T |
50567427 |
gtatcatacaaaagtgtggttttcccgtcaaatttaaggtacaacatctactctttcatattatc---ttcgctgaaattgtttcatcaac |
50567514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University