View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6668_high_8 (Length: 286)
Name: NF6668_high_8
Description: NF6668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6668_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 27774710 - 27774433
Alignment:
| Q |
1 |
tggttcagtcaggagatcagaccccacagattttaggagtggctattcttctagctcacgaggtgcaatgtcatttgctgctgctgctatggctggactg |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774710 |
tggttcagtcaggggatcagaccccacagattttaggagtggctattcttctagctcacgaggtgcaatgtcatttgctgctgctgctatggctggactt |
27774611 |
T |
 |
| Q |
101 |
ggatctgccaatagcagaggaatcagagggggaagagaccggcacgggcgtcccttgtttggtagttctaatgatcctccaaagttaatattcactgctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774610 |
ggatctgccaatagcagaggaatcagagggggaagagaccggcacgggcgtcccttgtttggtagttctaatgatcctccaaagttaatattcactgctg |
27774511 |
T |
 |
| Q |
201 |
gtgggaaacaattgaacagacagttgactatttatcaagcagttcaaagacagcttgtacaagatgacgatgatgatg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774510 |
gtgggaaacaattgaacagacagttgactatttatcaagcagttcaaagacagcttgtacaagatgacgatgatgatg |
27774433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University