View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6668_high_9 (Length: 274)
Name: NF6668_high_9
Description: NF6668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6668_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 442294 - 442546
Alignment:
| Q |
13 |
aaaatatctacgtacaacttattgatctgagttgcacacagttattgataccagcaaatggattaaagtttcaattctaacatttgcttttttcaacagt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
442294 |
aaaatatctacgtacaacttattgatctgagttgcacacagttattgataccagcaaatggattaaagtttcaattctaacatttgctttt-tcaacagt |
442392 |
T |
|
| Q |
113 |
gattgtcggtgagattgctaattttgcagcatatgcatttgctccagctatattggtcactccgcttggtgctcttagcattattatcaggtatggcaat |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
442393 |
gattgtcggtgagattgccaattttgcagcatatgcatttgctccagctatattggtcactccgcttggtgctcttagcattattatcaggtatggcaat |
442492 |
T |
|
| Q |
213 |
tttaaccttcgtatttatgcttgactctttgtaaattctgatttgtgatgatgt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
442493 |
tttaaccttcgtatttatgcttgactctttgtaaattctgatttgtgatgatgt |
442546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University