View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6668_low_13 (Length: 249)
Name: NF6668_low_13
Description: NF6668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6668_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 2 - 242
Target Start/End: Complemental strand, 36606035 - 36605795
Alignment:
| Q |
2 |
aagcttgccaactaataggcctcataaagttagccagccaaagcttatgtacatctcaactggtgatgacaagttcatggtgagggaaagagtgtcctca |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606035 |
aagcttgccaaataataggcctcataaagttagccagccaaagcttatgtacatctcaactggtgatgacaagttcatggtgagggaaagagtgtcctca |
36605936 |
T |
 |
| Q |
102 |
gtggctgaaattgcacctctgaatatatctactaaaatttcaagccagaaagttttagaagaagagaagggaatggttttacagaatctagcaacagaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605935 |
gtggctgaaattgcacctctgaatatatctactaaaatttcaagccagaaagttttagaagaagagaagggaatggttttacagaatctagcaacagaaa |
36605836 |
T |
 |
| Q |
202 |
ggcctgcttctggccatcttcccccagcttttgatgatgtc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605835 |
ggcctgcttctggccatcttcccccagcttttgatgatgtc |
36605795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University