View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6668_low_15 (Length: 240)

Name: NF6668_low_15
Description: NF6668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6668_low_15
NF6668_low_15
[»] chr7 (1 HSPs)
chr7 (61-221)||(47117784-47117944)


Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 61 - 221
Target Start/End: Complemental strand, 47117944 - 47117784
Alignment:
61 taattgatgaattcaataagtaatttatttattttgaacgagtaagtaaaactttaaaacgatgaactttatatgaaaaaatataaagaatctattgaaa 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47117944 taattgatgaattcaataagtaatttatttattttgaacgagtaagtaaaactttaaaacgatgaactttatatgaaaaaatataaagaatctattgaaa 47117845  T
161 ctttatttaaattgagattgaagaagccaattaccactggtgcgggggaacgaggtcttgc 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47117844 ctttatttaaattgagattgaagaagccaattaccactggtgcgggggaacgaggtcttgc 47117784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University