View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6668_low_16 (Length: 238)
Name: NF6668_low_16
Description: NF6668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6668_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 5 - 224
Target Start/End: Original strand, 9904955 - 9905174
Alignment:
| Q |
5 |
ttttttgtgggacaacacaagcatcgttaaatagtttcatttccttaccatataacttcttctcaaatatcttaatttcttgtatttttcttaagatatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9904955 |
ttttttgtgggacaacacaagcatcgttaaatagtttcatttccttactatataacttcttctcaaatatcttaatttcttgtatttttcttaagatatt |
9905054 |
T |
|
| Q |
105 |
ttttgacaccaatggttcataaaaaattctacgaaatttcatttggttttgttgaaatggcttggattatgctaagtgttgactactcaagacttttatg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9905055 |
ttttgacaccaatggttcataaaaaattctacgaaatttcatttggttttgttgaaatggcttggattatgctaagtgttgactactcaagacttttatg |
9905154 |
T |
|
| Q |
205 |
gcaattatttggtgttttct |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9905155 |
gcaattatttggtgttttct |
9905174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University