View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6668_low_19 (Length: 208)
Name: NF6668_low_19
Description: NF6668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6668_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 27566424 - 27566603
Alignment:
| Q |
14 |
cacagacaaaacaaagcaaactatgaatcatttattccttttgtgaattttcgtgcctatatatttgtttatgtgcagggaattgagaaaaagatattgc |
113 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27566424 |
cacagacaaaacaaagcaaactttgaatcatttattccttttgtgaattttcgtgcctatatatttgtttatgtgcagagaattgagaaaaagatattgc |
27566523 |
T |
|
| Q |
114 |
taaactgaataagacatgcatgaattgctctgcttataaagctactttatcacatgataattgaaacataataatgaaat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27566524 |
taaactgaataagacatgcatgaattgctctgcttataaagctactttatcacatgataattgaaacataataatgaaat |
27566603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University