View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6668_low_4 (Length: 472)
Name: NF6668_low_4
Description: NF6668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6668_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 3e-18; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 13 - 60
Target Start/End: Original strand, 2946649 - 2946696
Alignment:
| Q |
13 |
aaaatatctcatgcaaataaatgaacaaattagagtctcgtcgtttac |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2946649 |
aaaatatctcatgcaaataaatgaacaaattagagtctcgtcgtttac |
2946696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 145 - 233
Target Start/End: Original strand, 2921523 - 2921611
Alignment:
| Q |
145 |
acaactcagataaaactacgtaaatttgaataaacatttcaacaagcagttatagttagagaaaaattgaaatgacaatgactgtgaac |
233 |
Q |
| |
|
|||||||| | ||||| |||| ||||||||||||| ||||||| ||| |||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
2921523 |
acaactcaaacaaaacgacgttaatttgaataaacttttcaacgagcgcttatagcaaaacaaaaattgaaatgacaatgactgtgaac |
2921611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 381 - 452
Target Start/End: Complemental strand, 3354282 - 3354211
Alignment:
| Q |
381 |
tactgtaaatctgttaaatatactggaaa-tgaatttggtactctggacaaataactaattgaagaaacatga |
452 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| ||||| | ||| ||||||||||||||||||||||||||| |
|
|
| T |
3354282 |
tactgtaaatctgttaaatgtactggaaaatgagtttggga-tctagacaaataactaattgaagaaacatga |
3354211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 330
Target Start/End: Complemental strand, 3354335 - 3354301
Alignment:
| Q |
296 |
tattgcaaatgcagggaataatgaatttgggaaca |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
3354335 |
tattgcaaatgcagggaataatgaatttggaaaca |
3354301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University