View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6669_low_3 (Length: 210)
Name: NF6669_low_3
Description: NF6669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6669_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 10 - 189
Target Start/End: Original strand, 39185001 - 39185182
Alignment:
| Q |
10 |
aacaatatcaccaaaaccagtaccaaacctgaaagcatgtgagacacccagagnnnnnnngtcgatatatacccaaaaccgccaaaa---aaccaagcaa |
106 |
Q |
| |
|
||||| |||||||||||||||||| ||| |||||||| ||||||||||||||| ||||||||||||| |||||| | |||| |||||||||| |
|
|
| T |
39185001 |
aacaaaatcaccaaaaccagtaccgaacgtgaaagcacgtgagacacccagagaaaaaa-gtcgatatatacctaaaaccacaaaaaaaaaaccaagcaa |
39185099 |
T |
 |
| Q |
107 |
ccagcaccactacccaccgtgtatggccgtcggaaagctggtgacaacaccaccaaacagtaacacaaaaacttaaacaaccc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39185100 |
ccagcaccactacccaccgtgtatggccgtcggaaagctggtgacaacaccaccaaacagtaacacaaaaacttaaacaaccc |
39185182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University