View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6671_high_4 (Length: 253)
Name: NF6671_high_4
Description: NF6671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6671_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 230
Target Start/End: Complemental strand, 28516095 - 28515871
Alignment:
| Q |
5 |
gagcagcacagagggcgacaaaaagtacagatcatgggcgaagaaggtggaacttccaagtttcaaacaacaataacctctaggctagattgctactgct |
104 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
28516095 |
gagcagcacaaagggcgacaaaaagtacagatcatgcgcgaagaaggtggaacttccaagtttcaaacaacgatatcctctaggctagattgctactgct |
28515996 |
T |
|
| Q |
105 |
gaaaacatttcaagtgcagacaataaaacatttatcttctcaaatgaatgccaaaagctacctttctccccacacctcttctgattatatatgataactg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28515995 |
gaaaacatttcaagtgcagacaataaaaca-ttatcttctcaaatgaatgccaaaagctacctttctccccacacctcttctgattatatatgataactg |
28515897 |
T |
|
| Q |
205 |
aattctcctcatgattccctatttta |
230 |
Q |
| |
|
|||||||| |||||||||||| |||| |
|
|
| T |
28515896 |
aattctccacatgattccctaattta |
28515871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University