View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6672_high_7 (Length: 250)
Name: NF6672_high_7
Description: NF6672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6672_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 240
Target Start/End: Original strand, 1451564 - 1451794
Alignment:
| Q |
10 |
aatgtcagagtcttgtatgaaatcaaagcataaaccacaaaaggattttggaggtagtgaagaacattcacagctggtctcaatagtttctttcttcaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1451564 |
aatgtcagagtcttgtatgaaatcaaagcataaaccacaaaaggattttggaggtagtgaagaacattcacagctggtctcaatagtttctttcttcaac |
1451663 |
T |
 |
| Q |
110 |
tctttctcattacttgttactgaacatttgagaatccctttcaaattttgttgttggaattcattacacttcactttcactgagttttgatttggttgat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1451664 |
tctttctcattacttgttactgaacatttgagaatccttttcaaattttgttgttggaattcattacacttcactttcactgagttttgatttggttgat |
1451763 |
T |
 |
| Q |
210 |
caatggtgaatgtgactttcttcctcttctt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1451764 |
caatggtgaatgtgactttcttcctcttctt |
1451794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 155 - 200
Target Start/End: Original strand, 1455393 - 1455438
Alignment:
| Q |
155 |
ttttgttgttggaattcattacacttcactttcactgagttttgat |
200 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||| ||||||||| |
|
|
| T |
1455393 |
ttttgttgttgaaattcattgcaattcactttcactaagttttgat |
1455438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University