View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6676_high_10 (Length: 260)
Name: NF6676_high_10
Description: NF6676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6676_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 124
Target Start/End: Original strand, 15985916 - 15986022
Alignment:
| Q |
18 |
gtttgtgcagccatcaacaatccattacaataccggaaacttggtgactctgaccttaatatcagtgaaatcactcttggtactgtaagtttacttcttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15985916 |
gtttgtgcagccatcaacaatccattacaataccggaaacttggtgactctgaccttaatatcagtgaaatcactcttggtactgtaagtttacttcttc |
15986015 |
T |
|
| Q |
118 |
tcacatt |
124 |
Q |
| |
|
||||||| |
|
|
| T |
15986016 |
tcacatt |
15986022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 197 - 240
Target Start/End: Original strand, 15986094 - 15986137
Alignment:
| Q |
197 |
agagactcacgtattgagtctaacttagtgcatgttttgttctg |
240 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15986094 |
agagtctcacgtattgagtctaacttagtgcatgttttgttctg |
15986137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University