View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6676_high_8 (Length: 273)
Name: NF6676_high_8
Description: NF6676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6676_high_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 273
Target Start/End: Complemental strand, 33535348 - 33535094
Alignment:
| Q |
17 |
cactatttttagttttaacaggagttctcattggcctcagattttaaccaaattctatgctctcttggtcaggaggtagaaatctgtaaaataaaagggg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33535348 |
cactatttttagttttaacaggagttctcgttggcctcagattttaaccaaattctaagctctcttggtcaggaggtagaaatctgtaaaataaaggggg |
33535249 |
T |
 |
| Q |
117 |
cacattgtaggaagaaaaagcttctgtagaaatattggtttgtgatacttttctggaattacgataaagcaaaggatttggattaatgcaagtgccaaaa |
216 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33535248 |
ca--ttgtaggaagaaaaaacttctgtagaaatattggtttgtgatacttttctggaattacgataaagcaaaggatttggattaatgcaagtgccaaaa |
33535151 |
T |
 |
| Q |
217 |
gggaagagggtatttactcagtacggaatggaaacaaagcagacagagaatatattt |
273 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
33535150 |
gggaagagggtatttactcagtatggaatggaaacaaagcagacagagaatacattt |
33535094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University