View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6676_low_11 (Length: 272)
Name: NF6676_low_11
Description: NF6676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6676_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 26276497 - 26276254
Alignment:
| Q |
18 |
aatgattgctgagcaatcctcatggtcaataggtaatgggaacactgtcaacttctggacagataaatggttagaacaatctattgtggaatctcttaat |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26276497 |
aatgaatgctgagcaatcctcatggtcaataggtaatgggaacactgtcaacttctggacagacaaatggttagaacaatctattgtggaatctcttaat |
26276398 |
T |
 |
| Q |
118 |
atccctctgcacatgcaccctgcccttaacatgaaggtagcagattacattctggatggtaattggaatatccccatgtatctgatacaaaagtctaaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26276397 |
atccctctgcacatgcaccctgcccttaacatgaaggtagcagattacattctggatggtaattggaatatccccatgtatctgatacaaaagtctaaag |
26276298 |
T |
 |
| Q |
218 |
agttagcaaagcaaattctcacggttaccctctctattgatgat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26276297 |
agttagcaaagcaaattctcacggttaccctctctattgatgat |
26276254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University