View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6677_2D_low_25 (Length: 217)

Name: NF6677_2D_low_25
Description: NF6677_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6677_2D_low_25
NF6677_2D_low_25
[»] chr3 (1 HSPs)
chr3 (164-208)||(8431318-8431362)


Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 8431362 - 8431318
Alignment:
164 aagttgcatgcatatttaccttaatcgatgtatgatgtccatctc 208  Q
    ||||||||||||||||||||||||||||||||||||||| |||||    
8431362 aagttgcatgcatatttaccttaatcgatgtatgatgtcaatctc 8431318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University