View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6677_2D_low_26 (Length: 206)
Name: NF6677_2D_low_26
Description: NF6677_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6677_2D_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 2 - 193
Target Start/End: Complemental strand, 40533655 - 40533462
Alignment:
| Q |
2 |
tttaatttacctagtaatagatg--atgatataactatattcatataaatatgtaggttgaagtgagtgccacgccagtgggatcagttagtgaatgtgc |
99 |
Q |
| |
|
||||||||||||||||||| ||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40533655 |
tttaatttacctagtaatacatgctataacataactatattcatataaatatgtaggttgaagtgagtgccacgccagtgggatcagttagtgaatgtgc |
40533556 |
T |
|
| Q |
100 |
aaaatcaatagtgaatggtacattgaggggagatagatacttgactgcaccagcttggtttagaatgacatatgttgtgaaagtgtgatgtcca |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40533555 |
aaaatcaatagtgaatggtacattgaggggagatagatacttgactgcaccagcttggtttagaatgacatatgttgtgaaagtgttatgtcca |
40533462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University