View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6677_low_9 (Length: 246)
Name: NF6677_low_9
Description: NF6677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6677_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 35519574 - 35519786
Alignment:
| Q |
20 |
tgctgatcagctacagcaatttttggttgaacatcaaagcgaaactaactgcaccgaagatgattcaaaccggatcgttcaaaatgcaatacaatcgcgg |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35519574 |
tgctgatcagctacggcaatttttggttgaacatcaaagcgaaactaactgcaccgaagatgattcaaaccggatcgttcaaaatgcaatacaatcgcgg |
35519673 |
T |
 |
| Q |
120 |
aaaagtggtgatgctggtgatggcatttccggtaccggagagggactcacccttgaagaattcttccattttttgttctatgatgaatttaatggtccca |
219 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35519674 |
aaaagtggtgttgctggtgatggcatttccggcaccggagaggaactcacccttgaagaattcttccagtttttgttctatgatgaatttaatggtccca |
35519773 |
T |
 |
| Q |
220 |
taaaatcacaggt |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35519774 |
taaaatcacaggt |
35519786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University