View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_high_18 (Length: 317)
Name: NF6681_2D_high_18
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 25 - 201
Target Start/End: Complemental strand, 28609991 - 28609815
Alignment:
| Q |
25 |
caaatttcaagcacttgaacaagttctcaatgaccttgaagcttcattggagaaaggcatcaaaattgaccctgaaatttatgcttctttgttagaaact |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609991 |
caaatttcaagcacttgaacaagttctcaatgaccttgaagcttcattggagaaaggcatcaaaattgaccctgaaatttatgcttctttgttagaaact |
28609892 |
T |
 |
| Q |
125 |
tgttaccgtttcggagctattcatcatggtatccggcttcaccgtcttatcccaccagcccttttgcatagaaatgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609891 |
tgttaccgtttcggagctattcatcacggtatctggcttcaccgtcttatcccaccagcccttttgcatagaaatgt |
28609815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 195 - 317
Target Start/End: Original strand, 28609600 - 28609722
Alignment:
| Q |
195 |
gaaatgtgaaaatatctggttcaacaccctcttccaccatttgaaaataaagcgcaatagcatcatcataaagacccatctctgcatatccagatatcaa |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609600 |
gaaatgtgaaaatatctggttcaacaccctcttccaccatttgaaaataaagcgcaatagcatcatcataaagacccatctctgcatatccagatatcaa |
28609699 |
T |
 |
| Q |
295 |
ggaattccacggaaacgcataca |
317 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28609700 |
cgaattccacggaaacgcataca |
28609722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University