View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_high_28 (Length: 259)
Name: NF6681_2D_high_28
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_high_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 46 - 259
Target Start/End: Original strand, 28609509 - 28609722
Alignment:
| Q |
46 |
tcatcccaaaacccacaacgcaccacatgacgatgcacctcttccccaactcccaccaacccaattccaccacaaactttaagaacacgaggaaatgtga |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609509 |
tcatcccaaaacccacaacgcaccacatgacgatgcacctcttccccaacacccaccaacccaattccaccacaaactttaagaacacgaggaaatgtga |
28609608 |
T |
 |
| Q |
146 |
aaatatctggttcaacaccctcttccaccatttgaaaataaagcgcaatagcatcatcataaagacccatctctgcatatccagatatcaaggaattcca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28609609 |
aaatatctggttcaacaccctcttccaccatttgaaaataaagcgcaatagcatcatcataaagacccatctctgcatatccagatatcaacgaattcca |
28609708 |
T |
 |
| Q |
246 |
cggaaacgcataca |
259 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28609709 |
cggaaacgcataca |
28609722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University