View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6681_2D_high_28 (Length: 259)

Name: NF6681_2D_high_28
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6681_2D_high_28
NF6681_2D_high_28
[»] chr3 (1 HSPs)
chr3 (46-259)||(28609509-28609722)


Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 46 - 259
Target Start/End: Original strand, 28609509 - 28609722
Alignment:
46 tcatcccaaaacccacaacgcaccacatgacgatgcacctcttccccaactcccaccaacccaattccaccacaaactttaagaacacgaggaaatgtga 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
28609509 tcatcccaaaacccacaacgcaccacatgacgatgcacctcttccccaacacccaccaacccaattccaccacaaactttaagaacacgaggaaatgtga 28609608  T
146 aaatatctggttcaacaccctcttccaccatttgaaaataaagcgcaatagcatcatcataaagacccatctctgcatatccagatatcaaggaattcca 245  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
28609609 aaatatctggttcaacaccctcttccaccatttgaaaataaagcgcaatagcatcatcataaagacccatctctgcatatccagatatcaacgaattcca 28609708  T
246 cggaaacgcataca 259  Q
    ||||||||||||||    
28609709 cggaaacgcataca 28609722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University