View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_high_37 (Length: 215)
Name: NF6681_2D_high_37
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_high_37 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 137796 - 137992
Alignment:
| Q |
19 |
gtaaatcttgccttcatatgccttttatataaacttggaactacgtcttcttcatcttgatatttttattgacctttacattttacatctaggtaaccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137796 |
gtaaatcttgccttcatatgccttttatataaacttggaactacttcttcttcatcttgatatttttattgacctttacattttacatctaggtaaccat |
137895 |
T |
 |
| Q |
119 |
tttccaccgttgttaatgactagatattatctctactatactcaaaagttcaaattcgaaagtgtcttgcacacaaagttgtttcaatatatcctgc |
215 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
137896 |
tttccaccgttgttgatgactacatattatctctactatactaaaaagttcaaattcgaaagtgtcttgcacacaaagttgttttaatatatcctgc |
137992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 137550 - 137379
Alignment:
| Q |
19 |
gtaaatcttgccttcatatgccttttatataaacttggaactacgtcttcttcatcttgatatttttattgacctttacattttacatctaggtaaccat |
118 |
Q |
| |
|
|||||| ||||||||||| ||||| || |||||| | ||||||| ||||||||| ||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
137550 |
gtaaattttgccttcatacgccttctaaataaaccttgaactac---ttcttcatcatgatattttagttgacctttacattttacatataggtaaccat |
137454 |
T |
 |
| Q |
119 |
tttccaccgttgttaatgactagatattatctctactatactcaaaagttcaaattcgaaagtgtcttgcacacaaag |
196 |
Q |
| |
|
||||||| |||| ||||||||| ||||| |||||| ||||||||||||| |||| |||| |||||||||| |||| |
|
|
| T |
137453 |
tttccactgttggtaatgacta---attatttctactgcactcaaaagttcatattcaaaagagtcttgcacataaag |
137379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University