View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_high_40 (Length: 207)
Name: NF6681_2D_high_40
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_high_40 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 2255512 - 2255323
Alignment:
| Q |
18 |
aatagcatgcgtctgttctttgcaggttgatgcgccgttacattcccaccaccacccgacaacctcctgtagccggtaacctgtcagtcaccaccacccc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2255512 |
aatagcatgcgtctgttctttgcaggttgatgcgccgttacattcccaccaccacccgacaacctcctgtagccggtaacatgtcagtcaccaccacccc |
2255413 |
T |
 |
| Q |
118 |
tctccccccattaaatattcaaatgcacataacttatgtcttgtgtaggagtaagtaacaagtacatataattattctagtttcgtagac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2255412 |
tctccccccattaaatattcaaatgcacataacttatgtcttgtgtaggagtaagtaataagtacatataattattctagtttcgtagac |
2255323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University