View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_high_41 (Length: 203)
Name: NF6681_2D_high_41
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_high_41 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 97 - 203
Target Start/End: Original strand, 42330025 - 42330131
Alignment:
| Q |
97 |
tatttagttgtctacattgaaatcaagaagaaatctctaaacaaaagttttaaaaactgaaaggtactcaaacctatcttaactaaggaagaaattcacg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42330025 |
tatttagttgtctacattgaaatcaagaagaaatctctaaacaaaagttttcaaaactgaaaggtactcaaacctaacttaactaaggaagaaattcacg |
42330124 |
T |
|
| Q |
197 |
aaaaatt |
203 |
Q |
| |
|
||||||| |
|
|
| T |
42330125 |
aaaaatt |
42330131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 42329960 - 42330009
Alignment:
| Q |
19 |
attgtattgtaaaaagaaaatgtatacacata-ggataaatgttgaactc |
67 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
42329960 |
attgtattgtaaaaagaaaatgtatacacgtagggataaatgttgaactc |
42330009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University