View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_low_27 (Length: 346)
Name: NF6681_2D_low_27
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_low_27 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 128 - 346
Target Start/End: Original strand, 2176453 - 2176672
Alignment:
| Q |
128 |
agttagatgttgaaaatacaaattatcagtcannnnnnnatgttgctaaaactactttcatattgaaattgataagatatcaaattagcatttctctgtt |
227 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176453 |
agttagatgttgaaaagacaaattatcagtcatttttttatgttgctaaaactactttcatattgaaattgataagatatcaaattagcatttctctgtt |
2176552 |
T |
 |
| Q |
228 |
cttgcaaaatgtgtagacaatatatacaatagtgtagtccaagtacttttggaactccc-aagactcacacagaaacacactaacactgcataccgtgtt |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
2176553 |
cttgcaaaatgtgtagacaatatatacaatagtgtagtccaagtacttttgggactcccaaagactcacaaggaaacacactaacactggataccgtgtt |
2176652 |
T |
 |
| Q |
327 |
ctacggtgtctcgaaccaaa |
346 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2176653 |
ctacggtgtctcgaaccaaa |
2176672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 2176340 - 2176388
Alignment:
| Q |
15 |
atcaataattaactgattgactcgaataaattgttcttagaagtaaaac |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176340 |
atcaataattaactgattgactcgaataaattgttcttagaagtaaaac |
2176388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University