View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_low_36 (Length: 318)
Name: NF6681_2D_low_36
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 25 - 315
Target Start/End: Complemental strand, 28609991 - 28609701
Alignment:
| Q |
25 |
caaatttcaagcacttgaacaagttctcaatgaccttgaagcttcattggagaaaggcatcaaaattgaccctgaaatttatgcttctttgttagaaact |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609991 |
caaatttcaagcacttgaacaagttctcaatgaccttgaagcttcattggagaaaggcatcaaaattgaccctgaaatttatgcttctttgttagaaact |
28609892 |
T |
 |
| Q |
125 |
tgttaccgtttcggagctattcatcatggtatccggcttcaccgtcttatcccaccagcccttttgcatagaaatgttggaataagttctaaacttgtta |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609891 |
tgttaccgtttcggagctattcatcacggtatctggcttcaccgtcttatcccaccagcccttttgcatagaaatgttggaataagttctaaacttgtta |
28609792 |
T |
 |
| Q |
225 |
ggttgtatgcttcatttgggtatatggatgatgcacatgacttgtttgatcaaatgactaagagggatatgtatgcgtttccgtggaattc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609791 |
ggttgtatgcttcatttgggtatatggatgatgcacatgacttgtttgatcaaatgactaagagggatatgtatgcgtttccgtggaattc |
28609701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University