View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_low_55 (Length: 264)
Name: NF6681_2D_low_55
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 43531803 - 43531564
Alignment:
| Q |
1 |
gtcgagttaagcccaactcaaaattctaatatggtattagagcttatccatttagtgccaccgactacttacaagttggtttgtattaattgttggttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
43531803 |
gtcgagttaagcccaactcaaaattctaatatggtattagagcttatccatttagcgccaccgacta---------tggtttgtattaattgtaggttag |
43531713 |
T |
 |
| Q |
101 |
ttaaagtttcttactatcctatagttacacgatcattcttacaatttatttgtttctttattgcactctaccatatttctcagtatctagtggaggcata |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43531712 |
ttaaagtttgttactatcctatagttacacgatcattcttacaatttatttgtttctttattgcactctaccatatttctcagtatctagtggaggcata |
43531613 |
T |
 |
| Q |
201 |
tgagactcgagtagcagaaacagagaagaaaaagctaatggttccaatt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43531612 |
tgagactcgagtagcagaaacagagaagaaaaagctaatggttccaatt |
43531564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 181 - 243
Target Start/End: Original strand, 24128063 - 24128125
Alignment:
| Q |
181 |
cagtatctagtggaggcatatgagactcgagtagcagaaacagagaagaaaaagctaatggtt |
243 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
24128063 |
cagtatctagtggaggcatatgaatctcgagttgcggaaacagagaagaaaaagataatggtt |
24128125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 24145825 - 24145877
Alignment:
| Q |
181 |
cagtatctagtggaggcatatgagactcgagtagcagaaacagagaagaaaaa |
233 |
Q |
| |
|
|||||||| |||||||||| ||| ||||| | |||||||||||||||||||| |
|
|
| T |
24145825 |
cagtatctggtggaggcatttgaatctcgacttgcagaaacagagaagaaaaa |
24145877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University