View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_low_58 (Length: 260)
Name: NF6681_2D_low_58
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 137 - 257
Target Start/End: Complemental strand, 28609821 - 28609701
Alignment:
| Q |
137 |
gaaatgttggaataagttctaaacttgttaggttgtatgcttcatttgggtatatggatgatgcacatgacttgtttgatcaaatgactaagagggatat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609821 |
gaaatgttggaataagttctaaacttgttaggttgtatgcttcatttgggtatatggatgatgcacatgacttgtttgatcaaatgactaagagggatat |
28609722 |
T |
|
| Q |
237 |
gtatgcgtttccgtggaattc |
257 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28609721 |
gtatgcgtttccgtggaattc |
28609701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 46 - 143
Target Start/End: Original strand, 28609509 - 28609606
Alignment:
| Q |
46 |
tcatcccaaaacccacaacgcaccacatgacgatgcacctcttccccaactcccaccaacccaattccaccacaaactttaagaacacgaggaaatgt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609509 |
tcatcccaaaacccacaacgcaccacatgacgatgcacctcttccccaacacccaccaacccaattccaccacaaactttaagaacacgaggaaatgt |
28609606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University