View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_low_67 (Length: 240)
Name: NF6681_2D_low_67
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 8 - 222
Target Start/End: Original strand, 23975601 - 23975815
Alignment:
| Q |
8 |
agatgaaggtgaaaccagggatgacatacttactacgaataatcaatgttgcactcaataatcatcttttcttcaaaatagcaaatcacaatttcacagt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23975601 |
agatgaaggtgaaaccagggatgacatacttgctacggataatcaatgttgcactcaataacaatcttttcttcaaaatagcaaatcacagtttcacagt |
23975700 |
T |
 |
| Q |
108 |
tgttgcactagatgctgactacaccgatccattcaagaccgacgtcatcgttatcgcccctggccaaacggttgatgctttgttcacagcaaaccaacct |
207 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| |||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
23975701 |
tgttgcactggatgctgactacacgaatccattcgagactgacatcatcgttatcgcccctggccaaacagttgatgctttgttcacagcaaatcaacct |
23975800 |
T |
 |
| Q |
208 |
ataggctcatactac |
222 |
Q |
| |
|
||||| || |||||| |
|
|
| T |
23975801 |
ataggatcttactac |
23975815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 6026096 - 6026172
Alignment:
| Q |
34 |
tacttactacgaataatcaatgttgcactcaataatcatcttttcttcaaaatagcaaatcacaatttcacagttgt |
110 |
Q |
| |
|
||||||||||| || ||||||| |||||||||| | || | ||||||||| |||||||| || | |||||||||||| |
|
|
| T |
6026096 |
tacttactacgcattatcaatgctgcactcaatgaacaacatttcttcaagatagcaaaccatagtttcacagttgt |
6026172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University