View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_2D_low_87 (Length: 205)
Name: NF6681_2D_low_87
Description: NF6681_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_2D_low_87 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 136 - 205
Target Start/End: Original strand, 15112857 - 15112926
Alignment:
| Q |
136 |
atatgagaatagtgtagttacttcgttcatctaataataactattagtaataagataaacaatagcattt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||| |
|
|
| T |
15112857 |
atatgagaatagtgtagttacttcgttcatctaataataaatagtagtaataagataaacgatagcattt |
15112926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University