View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_high_6 (Length: 201)
Name: NF6681_high_6
Description: NF6681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 8 - 180
Target Start/End: Original strand, 52964190 - 52964362
Alignment:
| Q |
8 |
ggagtagcataggaaaaggttcatagcacgtggggtcaatgtgcatctgtttgataacaatatttcagggaattaatcactcaatcatatttgaacacgt |
107 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52964190 |
ggagcagcatgggaaaaagttcatagcacgtggggtcaatgtgtatctgtttgctaacaatatttcagggaattaatcactcaatcatatttgaacacgt |
52964289 |
T |
 |
| Q |
108 |
gtcaaaagttaaggattccaaccattcacgatccatctctgttttattataaattggcaacaatatggtgccc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52964290 |
gtcaaaagttaaggattccaaccattcacgatccatctctgttttattataaattggcaacaatatggtgccc |
52964362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University