View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6681_low_6 (Length: 255)
Name: NF6681_low_6
Description: NF6681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6681_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 15288911 - 15288674
Alignment:
| Q |
18 |
tgtgactatgagttattgactttgttgactagcttgtaattttgactcttcaatttaaagctagcatttttgttgtttgagaagaagattaatggctccg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15288911 |
tgtgactatgagttattgactttgttgactagcttgtaattttgactcttcaatttaaagctagcatttttcttgtttgagaagaagattaatggctccg |
15288812 |
T |
|
| Q |
118 |
ttgaagatccaaccgattgacatagattcagagaaagccactacggaactggttcgaaatgaaccagtttcgaaatggaggttgaagaggtttttcgctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15288811 |
ttgaagatccaaccgattgacatagattcagagaaagccactacggaactggttcgaaatgaaccagtttcgaagtggaggttgaagaggtttttcgctt |
15288712 |
T |
|
| Q |
218 |
tcgagaaaccttttccgaagaacaataccactaaagat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288711 |
tcgagaaaccttttccgaagaacaataccactaaagat |
15288674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University