View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_high_15 (Length: 414)
Name: NF6682_2D_high_15
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 18 - 393
Target Start/End: Complemental strand, 2783519 - 2783149
Alignment:
| Q |
18 |
caaagtcaccgcacttttctcggtccatggtatgacttgctccgcttgcgctggatctgtggagaaatccatcaaacggctacatggaattcatgaagct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783519 |
caaagtcaccgcacttttctcggtccatggtatgacttgctccgcttgcgctggatctgtggagaaatccatcaaacggctacatggaattcatgaagct |
2783420 |
T |
|
| Q |
118 |
gttgttgatgtacttcataaccgtgcccgcgtcatctttcacccctcttttgttaacgtacgtaactcacccctcttttattcattttgtgtgatttact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2783419 |
gttgttgatgtacttcataaccgtgcccgcgtcatctttcacccctcttttgttaacgtacgtaactcacccctcttttattcattttgtgtggtttact |
2783320 |
T |
|
| Q |
218 |
gagattcagtctttgtcgtttttcatctttactcgtgtgttattagatttaaatgttagttatacaatttagtgacacgatgttttgttggataatatga |
317 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783319 |
gaga-----tctttgtcgtttttcatctttactcgtgtgttattagatttaaatgttagttatacaatttagtgacacgatgttttgttggataatatga |
2783225 |
T |
|
| Q |
318 |
atatccgtgttagtggcatagccagaaatttaacctaggtgttcaaatcttttagttttagagcttttgtctagtg |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
2783224 |
atatccgtgttagtggcatagccagaaatttaacctaggtgttcaaatttttgagttttagagcttttgtttagtg |
2783149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University