View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_high_22 (Length: 346)
Name: NF6682_2D_high_22
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 16 - 329
Target Start/End: Complemental strand, 50568766 - 50568454
Alignment:
| Q |
16 |
tgaacaatcccaggtgcaagataataacctcctgccctaaactaaattttggatctatgttttggtaattatttaactaataattgcatcattccgattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50568766 |
tgaacaatcccaggtgcaagataataacctcctgccctaaactaaattttggatctatgttttggtaattatttaactaataattgtatcattccgattt |
50568667 |
T |
|
| Q |
116 |
gtggaataatttctctgccgtaggtgtgattttcctgaatgatcttagggtatttagtggatatgtactgaaacatttagtagctttgatttttcgttgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50568666 |
gtggaataatttctctgccgtaggtgtgattttcctgaatgatcttagggtatttagtggatatgtactgaaacatttagtagctttgatttttcgttgc |
50568567 |
T |
|
| Q |
216 |
aacctatgttccttgcagtttggttaccctttttcattggaatttcttcttttgctcttctttttgatgctatgtgtttaaatgacaatttctgaagcac |
315 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50568566 |
aacctatgttccttgcagtttggttaccc-ttttcattggaatttcttcttttgctcttctttttgatgctatgtgtttaaatgacaatttctgaagcac |
50568468 |
T |
|
| Q |
316 |
acatggtaaattat |
329 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50568467 |
acatggtaaattat |
50568454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University