View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_high_37 (Length: 255)
Name: NF6682_2D_high_37
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 108 - 245
Target Start/End: Original strand, 5414181 - 5414318
Alignment:
| Q |
108 |
acaaccttctgcatccgctatcacttaatggatgcagtcatgactggttatgtagtttctaatgcggtatatgatgtccatacctaaaacatgcaaaatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5414181 |
acaaccttctgcatccgctatcacttaatggatgcagtcatgactggttatgtagtttctaatgcggtatatgatgtctatacctaaaacatgcaaaatc |
5414280 |
T |
 |
| Q |
208 |
acatatacatagtttctgatgcggtatatgatgtccat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5414281 |
acatatacatagtttctgatgcggtatatgatgtccat |
5414318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 5414098 - 5413987
Alignment:
| Q |
1 |
ctccaaccccaacaacaccatgttgaggaggaggatgatgattcagataattcagaggaagaggcgaatgacgatgatgagcacccacaacatgtggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5414098 |
ctccaaccccaacaacaccatgttgaggaggaggatgatgattcagataattcagaggaagaggcgaatgacgatgatgagcacccacaatatgtggaga |
5413999 |
T |
 |
| Q |
101 |
aggagtcacaac |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5413998 |
aggagtcacaac |
5413987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 5414290 - 5414347
Alignment:
| Q |
160 |
tagtttctaatgcggtatatgatgtccatacctaaaacatgcaaaatcacatatacat |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
5414290 |
tagtttctgatgcggtatatgatgtccatgcctaaaacatgcaaaatcacatacacat |
5414347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University