View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_high_42 (Length: 236)
Name: NF6682_2D_high_42
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 32 - 217
Target Start/End: Complemental strand, 41301427 - 41301242
Alignment:
| Q |
32 |
taagttggctatgatgttgaaaatgaactcaaagtagttagtagcttgctctagacagactaagagcaagagaatgcaattgattgctgcttgccagcac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41301427 |
taagttggctatgatgttgaaaatgaactcaaagtagttagtagcctgctctagacagactaagagcaagagaatgcaattgattgctgcttgccagcac |
41301328 |
T |
 |
| Q |
132 |
cccatgaacaagtgcttacccaactgtagcctcaagaaaataaaagcaatacgccgtcccaaaatacgtgacctttttgactgttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41301327 |
cccatgaacaagtgcttacccaactgtagcctcaagaaaataaaagcaatacgccgtcccaaaatacgtgacctttttgactgttg |
41301242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University