View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_high_44 (Length: 230)
Name: NF6682_2D_high_44
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_high_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 2780917 - 2781131
Alignment:
| Q |
1 |
tcaatttttagccaaccaacattcacagagaaaatccataattcaaggagct----aatctaattctaaagacaaatgctaaccttatgtgcactttcca |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2780917 |
tcaatttttagccaaccaacattcacagagaaaatccataattcaaggagctagctaatctaattctaaagacaaatgctaaccttatgtgcactttcca |
2781016 |
T |
|
| Q |
97 |
aagcttgcccccctttgatcaatacaccctgagatgcaccaactccagttccaaccataacagcggtaggtgtggctaaacccaaagcacaagggcaggc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2781017 |
aagcttgcccccctttgatcaatacaccctgagatgcaccaactccagttccaaccataacagcggtaggtgtggctaaacccaaagcacaagggcaagc |
2781116 |
T |
|
| Q |
197 |
tataaccatgacaga |
211 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2781117 |
aataaccatgacaga |
2781131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 78 - 213
Target Start/End: Complemental strand, 33901815 - 33901680
Alignment:
| Q |
78 |
accttatgtgcactttccaaagcttgcccccctttgatcaatacaccctgagatgcaccaactccagttccaaccataacagcggtaggtgtggctaaac |
177 |
Q |
| |
|
||||| ||||||||||| || ||||| || ||||||||||| ||||| |||| |||||||||||| || |||||||| || || ||||| ||||||| | |
|
|
| T |
33901815 |
accttgtgtgcactttctaatgcttggccacctttgatcaacacaccttgagttgcaccaactccggtaccaaccatgaccgctgtaggagtggctaggc |
33901716 |
T |
|
| Q |
178 |
ccaaagcacaagggcaggctataaccatgacagaaa |
213 |
Q |
| |
|
| | ||||||||| || ||||| |||||||| |||| |
|
|
| T |
33901715 |
ctagagcacaaggacaagctatgaccatgactgaaa |
33901680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 154
Target Start/End: Complemental strand, 33919337 - 33919261
Alignment:
| Q |
78 |
accttatgtgcactttccaaagcttgcccccctttgatcaatacaccctgagatgcaccaactccagttccaaccat |
154 |
Q |
| |
|
||||| ||||||||||| || ||||| || ||||||||||| ||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
33919337 |
accttgtgtgcactttctaatgcttggccacctttgatcaacacaccttgagttgcaccaactccagtaccaaccat |
33919261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University