View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_high_47 (Length: 219)
Name: NF6682_2D_high_47
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_high_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 31820523 - 31820622
Alignment:
| Q |
1 |
gttgtgagacacactcatttcttttgacaaaaaagaggtagatgtagtagaacttttgtgatttgtgtcggtgatgtaatgtgctcaaaattagtgtgtt |
100 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31820523 |
gttgtgagacacactctttttttttgacaaaaaagaggtagatgtagtagaacttttgtgatttgtgtcggagatgtaatgtgctcaaaattagtgtgtt |
31820622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 97 - 202
Target Start/End: Complemental strand, 31820455 - 31820351
Alignment:
| Q |
97 |
tgttacagatttaaactttgaataatggtaagaacaccttctcgaacacacactttcttacctactctatactattgattgaaattcacgtagattcctc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| | |||||| ||| |
|
|
| T |
31820455 |
tgttacagatttaaactttgaataatggtaagaacaccttctcgaacacacactttcttacctactctatgctattggttgaaattcccttagatt-ctc |
31820357 |
T |
|
| Q |
197 |
taaatt |
202 |
Q |
| |
|
|||||| |
|
|
| T |
31820356 |
taaatt |
31820351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University