View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_low_22 (Length: 472)
Name: NF6682_2D_low_22
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 1e-60; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 290 - 412
Target Start/End: Complemental strand, 3305287 - 3305165
Alignment:
| Q |
290 |
attcaagagttggtgactgtgattgacaagaaaggaactaacaaatggacatagctctcttctctacatcatctctcttcgccgaagaagatgatgacga |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305287 |
attcaagagttggtgactgtgattgacaagaaaggaactaacaaatggacatagctctcttctccacatcatctctcttcgccgaagaagatgatgacga |
3305188 |
T |
|
| Q |
390 |
tgacattcataccaagggtacta |
412 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3305187 |
tgacattcataccaagggtacta |
3305165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 52 - 169
Target Start/End: Complemental strand, 3305475 - 3305365
Alignment:
| Q |
52 |
gaaatcccaagttaaccattggatcaacctcaaaagagttaatttcggtttaattcataattcataacctaaaaaattgtgatttttggccccaattttg |
151 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3305475 |
gaaatcccaaattaaccattggatcaacctcaaatgagttaatttcggtttaattcataa-------cctaaaaaattgtgatttttggccccaattttg |
3305383 |
T |
|
| Q |
152 |
gatatgaagagaaagtac |
169 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3305382 |
gatatgaagagaaagtac |
3305365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 427 - 459
Target Start/End: Complemental strand, 3305142 - 3305110
Alignment:
| Q |
427 |
gcttgtttcttctttgattcctatgtttacaaa |
459 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
3305142 |
gcttgtttcttctttgattcctatgttgacaaa |
3305110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University