View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_low_43 (Length: 362)
Name: NF6682_2D_low_43
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 17 - 168
Target Start/End: Complemental strand, 31501476 - 31501325
Alignment:
| Q |
17 |
catcacctagtttgcattctcttcatgccacattacccctttatacttttagttgtctcaatatattaggatgttggaaaaatttgggatccacaataat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31501476 |
catcacctagtttgcattctcttcatgccacattacccctttatacttttagttgtctcaatatattaggatgttggaaaaatttgggatccacaataat |
31501377 |
T |
|
| Q |
117 |
ttgagttatagataagttagctatttggattttcaaattttcaaaagtgatg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31501376 |
ttgagttatagataagttagctatttggattttcaaattttcaaaagtgatg |
31501325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 200 - 308
Target Start/End: Complemental strand, 31501324 - 31501216
Alignment:
| Q |
200 |
gcaataggattaacacgtgtgcatttataaaattgcattggtgcagagtatgtagcaaattagatctgtaacgtaactacataaggtatgaccacgtcaa |
299 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31501324 |
gcaatgggattaatacgtgtgcatttataaaattgcattggtgcagagtatgtaccaacttagatctgtaacgtaactacataaggtatgaccacgtcaa |
31501225 |
T |
|
| Q |
300 |
gattagtct |
308 |
Q |
| |
|
||||||||| |
|
|
| T |
31501224 |
gattagtct |
31501216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 98 - 152
Target Start/End: Complemental strand, 31475945 - 31475891
Alignment:
| Q |
98 |
atttgggatccacaataatttgagttatagataagttagctatttggattttcaa |
152 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
31475945 |
atttgagatccacaataatttgagttatagataagctagctattttgatattcaa |
31475891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 90 - 135
Target Start/End: Complemental strand, 31465686 - 31465641
Alignment:
| Q |
90 |
ttggaaaaatttgggatccacaataatttgagttatagataagtta |
135 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31465686 |
ttggaaagatttgagatccacaataatttgagttatagataagtta |
31465641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 328
Target Start/End: Complemental strand, 31501200 - 31501168
Alignment:
| Q |
296 |
tcaagattagtctagtggtgaaggatttggata |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31501200 |
tcaagattagtctagtggtgaaggatttggata |
31501168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University