View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_low_44 (Length: 351)
Name: NF6682_2D_low_44
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 13 - 331
Target Start/End: Complemental strand, 46356863 - 46356542
Alignment:
| Q |
13 |
gagatgaacgtaggtggagttgagagaatcagagaggttgaggtagaagccttcgttggagaagagatcagagctggataatgcggggacaattccgatg |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||| |||||||||||||| ||| |
|
|
| T |
46356863 |
gagaagaacgtaggtggagttgagagaatcagagaggttgaggtagaagccttcgtttgaaaagagatcggagctggataaagcggggacaattccaatg |
46356764 |
T |
 |
| Q |
113 |
agttggagaagaggagaacggtggtcgccggtgacacgtgtatcggtgttcattgcttggaggagtttgaggattaggcctggtgttagtgaagccattg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46356763 |
agttggagaagaggagaacggtggtcgccggtgacacgtgtatcggtgttcattgcttggaggagtttgaggattaggcctggtgttagtgaagccattg |
46356664 |
T |
 |
| Q |
213 |
ttgtgt-----tgtgaattgagttgggttgtgtctgtctgagagagatgttatacagagcagtttctgttctcttgtgttgtgttttttgaattcaaaat |
307 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46356663 |
ttgtgttgtgttgtgaattgagttgggttgtg--tgtgtgagagagatgttatacagaggagtttctgttctcttgtgttgtgttttttgaattcaaaat |
46356566 |
T |
 |
| Q |
308 |
gttgatttgtccgttgtgcctatt |
331 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
46356565 |
gttgatttgtccgttatgcctatt |
46356542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University