View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_low_67 (Length: 276)
Name: NF6682_2D_low_67
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_low_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 43063040 - 43062795
Alignment:
| Q |
19 |
gatattttggttaagtggtggattatctctgattggaaagaagtatcataaagaccgtttgcatgttttgtcaactcaactacattattgtagcaagttg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43063040 |
gatattttggttaagtggtggattatctctgattggaaagaagtatcataaagaccgtttgcatgttttgtcaacacaactacattattgtagcaagttg |
43062941 |
T |
 |
| Q |
119 |
cattaatgtgacttatgtccactaatatcaacaacatatcttttggtgcgattcctctattatttctggggaaggtacaaaccattcataatatttttaa |
218 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43062940 |
cattaatgtgactaatgtccactaatatcaacaacatatcttttggtgcgattcctctattatttttggggaaggtacaaaccattcataatatttttaa |
43062841 |
T |
 |
| Q |
219 |
aatgttcctcagattcaaatattggctatagtcacccttatgatta |
264 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
43062840 |
aatgttcctcagattcaaatattagttatagtcactcttatgatta |
43062795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University