View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_low_73 (Length: 259)
Name: NF6682_2D_low_73
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_low_73 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 13 - 259
Target Start/End: Complemental strand, 2838821 - 2838575
Alignment:
| Q |
13 |
atggacatcagacaatacgagaggttaattgaagaaagagtttcttatgatgaagaagagatgaatattatgcaagagattcttataagaagggaaaagg |
112 |
Q |
| |
|
||||| || |||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2838821 |
atggaaatgagacaatatgagaggttaattgaagaaagagctgcttatgatgaagaagagatgaatattatgcaagagattcttataagaagggaaaagg |
2838722 |
T |
|
| Q |
113 |
agaatctctttttggaaaaggaatttgaaagttataggccatcactttcatttgaaacttgtgatgatccatcacaggcagaaagcatcgtatcaaatgt |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2838721 |
agaatctctttttggaaaaggaacttgaaagttataggccatcactttcatttgaaacttgtgatgatccatcacaggcagaaagcatcgtatcaaatgt |
2838622 |
T |
|
| Q |
213 |
gaagaaagattgcgctgatgcagaccatggagaagaggtggaggaaa |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2838621 |
gaagaaagattgcgctgatgcagaccatggagaagaggtggaggaaa |
2838575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 13 - 151
Target Start/End: Complemental strand, 2842922 - 2842784
Alignment:
| Q |
13 |
atggacatcagacaatacgagaggttaattgaagaaagagtttcttatgatgaagaagagatgaatattatgcaagagattcttataagaagggaaaagg |
112 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2842922 |
atggaaatgagacaatacgagaggttaattgaagaaagagtttcttatgatgaagaagagatgaatattatgcaagagattcttataagaagggaaaggg |
2842823 |
T |
|
| Q |
113 |
agaatctctttttggaaaaggaatttgaaagttataggc |
151 |
Q |
| |
|
| ||||| ||||||||||||||| |||||| || ||||| |
|
|
| T |
2842822 |
aaaatctttttttggaaaaggaacttgaaacttttaggc |
2842784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 189
Target Start/End: Complemental strand, 2842705 - 2842671
Alignment:
| Q |
155 |
cactttcatttgaaacttgtgatgatccatcacag |
189 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
2842705 |
cactttcatttgaaacatgtgatgatccatcacag |
2842671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University