View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_2D_low_97 (Length: 220)
Name: NF6682_2D_low_97
Description: NF6682_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_2D_low_97 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 31820547 - 31820351
Alignment:
| Q |
1 |
aaaagaaatgagtgtgtctcacaacggaatcgtaaaaatagagttttaatcaattcttctaaagaaaaattaactaaatttattaatctatatactgtgt |
100 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| || ||| |
|
|
| T |
31820547 |
aaaaaaaaagagtgtgtctcacaacggaatcgtaaaaatagagttttaatcgattcttctaaa-----attaactaaatttattaatctatatgctatgt |
31820453 |
T |
 |
| Q |
101 |
tacagatttaaactttgaataatggtaagaacaccttctcgaacacacactttcttacctactctatactattgattgaaattcacgtagattcctctaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| | |||||| |||||| |
|
|
| T |
31820452 |
tacagatttaaactttgaataatggtaagaacaccttctcgaacacacactttcttacctactctatgctattggttgaaattcccttagatt-ctctaa |
31820354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University