View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6682_low_5 (Length: 293)
Name: NF6682_low_5
Description: NF6682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6682_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 17 - 281
Target Start/End: Complemental strand, 10384816 - 10384552
Alignment:
| Q |
17 |
taacaatggtagatgaatcacatgcaaggccaggatctttgcttgaagttttactacaaagcttcaaatctggtctagacactcaaagatttttgaatca |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10384816 |
taaccatggtagatgaatcacatgcaaggccaggatctttgcttgaagttttactacaaagcttcaaatctggtctagacactcaaagatttttgaatca |
10384717 |
T |
|
| Q |
117 |
cttggttatcatagctatggacccccaagcttttgaatattgcagattgttgcatccacattgcatacatccctcgactttcgaaccttatttttccacc |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10384716 |
cttggttatcataactatggacccccaagcttttgaatattgcagattgttgcatccacattgcatccatccctcgactttcgaaccttatttttccacc |
10384617 |
T |
|
| Q |
217 |
aaaagacaatttatcacaagcccagatcacaatgtattcagttggagaagaaataatgttttgat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10384616 |
aaaagacaatttatcacaagcccagatcacaatgtattcagttggagaagaaataatgttttgat |
10384552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 281
Target Start/End: Complemental strand, 10381666 - 10381402
Alignment:
| Q |
17 |
taacaatggtagatgaatcacatgcaaggccaggatctttgcttgaagttttactacaaagcttcaaatctggtctagacactcaaagatttttgaatca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
10381666 |
taacaatggtagatgaatcacatgcaaggccaggatcattgcttgaagttttactacaaagcttcaaatctggccaagatactcaaagatttttgaatca |
10381567 |
T |
|
| Q |
117 |
cttggttatcatagctatggacccccaagcttttgaatattgcagattgttgcatccacattgcatacatccctcgactttcgaaccttatttttccacc |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| || |||||||| |||||||| |||||||| ||||| |||||||||||||| ||| |
|
|
| T |
10381566 |
cttggttatcataactatggacccccaagcttttgaatattgcaggttcttgcatcctcattgcatccatccctcaacttttgaaccttatttttcaacc |
10381467 |
T |
|
| Q |
217 |
aaaagacaatttatcacaagcccagatcacaatgtattcagttggagaagaaataatgttttgat |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10381466 |
aaaagacaatctatcactagcccagatcacagtgtattcagttggagaagaaataatgttttgat |
10381402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University