View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6685_2D_low_16 (Length: 253)
Name: NF6685_2D_low_16
Description: NF6685_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6685_2D_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 59 - 240
Target Start/End: Complemental strand, 1491555 - 1491378
Alignment:
| Q |
59 |
taagaacaaccaagaaatttgggaattctattcttctatttagctaaatgcgatttaaccagactaaatgacacataaattgtggaacatgaacttaatt |
158 |
Q |
| |
|
||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1491555 |
taagaacgacgaagaaatttgggaattatattcttctatttagctaaatgcgatttaaccagactaaatgacacataaattgtggaacatgaac----tt |
1491460 |
T |
 |
| Q |
159 |
agcaacatcagtgtcatgtcaccctccgttagtcccttttaatagttgagactaaatgtggagaggatcaaggaaaataatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
1491459 |
agcaacatcagtgtcatgtcaccctccgttagtcccttttaatagttgagactaaatggggagaggatcgaggaaaataatg |
1491378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 2 - 101
Target Start/End: Original strand, 1491585 - 1491684
Alignment:
| Q |
2 |
aaatatgagatttcagcattgctatgtctatggcttagtggtgatatgttgaagtcgtaagaacaaccaagaaatttgggaattctattcttctatttag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||| |
|
|
| T |
1491585 |
aaatatgagatttcagcattgctatgtctatggcttagtggtgatatgttgaagtcgtaagaatgatcaagaaatttggaaattctattcttctatttag |
1491684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University