View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6685_low_3 (Length: 364)
Name: NF6685_low_3
Description: NF6685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6685_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 150 - 344
Target Start/End: Original strand, 43062191 - 43062384
Alignment:
| Q |
150 |
ccttgaggaagaaaccaccaaggtcagagcacatagagaaaatcttatcggcagcaagctcatgctgtctttcccacattgcttcttgcttctgtgcatc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062191 |
ccttgaggaagaaaccaccaaggtcagagcacatagagaaaatcttatcggcagcaagctcatgctgtctttcccacattgcttcttgcttctgtgcatc |
43062290 |
T |
|
| Q |
250 |
tttcacgaaattgactctcaattgaaaaacctgcaattcgagaaaaatgaagcatgcatagttaattaattaatgtagcaatttggttagagaga |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062291 |
tttcacgaaattgactctcaattgaaaaacctgcaattcgag-aaaatgaagcatgcatagttaattaattaatgtagcaatttggttagagaga |
43062384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 43062042 - 43062126
Alignment:
| Q |
1 |
cagccttttcacccatgcagccggtgccaaatccggcttcccaataatttgtgcaatctgaatacaaaaatcaacaaaactagtt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062042 |
cagccttttcacccatgcagccggtgccaaatccggcttcccaataatttgtgcaatctgaatacaaaaatcaacaaaactagtt |
43062126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University