View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6687_2D_high_19 (Length: 222)
Name: NF6687_2D_high_19
Description: NF6687_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6687_2D_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 74 - 204
Target Start/End: Complemental strand, 53041508 - 53041378
Alignment:
| Q |
74 |
atgaggctagcattatatgaacgaaaagtcatcgggaacacgtgacttaccttcaagatcacatacgagtctccagtgaaaaactttccatgagaagact |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53041508 |
atgaggctagcattatatgaacgaaaagtcatcgagaacacgtgacttaccttcaagatcacatacgagtctccagtgaaaaactttccatgagaagact |
53041409 |
T |
 |
| Q |
174 |
gagggatgggaactggattaaagttctcaat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
53041408 |
gagggatgggaactggattaaagttctcaat |
53041378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 53041559 - 53041640
Alignment:
| Q |
1 |
gttatatagagattgatattttaagaaaacaaaacttatatacaatgctgtcgacattgttattattgttcttatgaggcta |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
53041559 |
gttatatagagattgatattttaagaaaacaaaacttatatacaatgctatcgacattgttattattgttcttatggggcta |
53041640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University