View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6687_2D_low_23 (Length: 307)
Name: NF6687_2D_low_23
Description: NF6687_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6687_2D_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 2 - 291
Target Start/End: Complemental strand, 29506848 - 29506559
Alignment:
| Q |
2 |
ataccaactaagttaagctcacgaggactgcatcactgctacttaccaagaagcatgatatttatgttgtgtacattgtttttgtttttccttccgcata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29506848 |
ataccaactaagttaagctcacgaggactgcatcactgctacttaccaagaagcatgatatttatgttgtgtacattgttttagtttttccttccgcata |
29506749 |
T |
 |
| Q |
102 |
ctcggttgcagttgtaattaaactggtgagggtgtgcaggtatgcaatgaaggtcacaatcacgaagcacttatgttttgtatgtcctatttctcaggta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29506748 |
ctcggttgcagttgtaattaaactggtgagggtgtgcaggtatgcaatgaaggtcacaatcacgaagcacttatcttttgtatgtcctatttctcaggta |
29506649 |
T |
 |
| Q |
202 |
aaatatatcaatactgtcatcaactgctttcaactaatgctagaggattacataaaataaactactacttgaatatatttggatcttttt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29506648 |
aaatatatcaatactgtcatcaactgctttcaactaatgctagaggattacataaaataaactactacttgagtatatttggatcttttt |
29506559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 16890487 - 16890516
Alignment:
| Q |
1 |
cataccaactaagttaagctcacgaggact |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16890487 |
cataccaactaagttaagctcacgaggact |
16890516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University